ENSDARG00000087859

Ensembl ID:
ENSDARG00000087859

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3258 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa3258
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128503 Nonsense 52 127 2 3
Genomic Location:
Chromosome 24 (position 42651164)
KASP Assay ID:
554-2710.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGGCGTCTGAGGAAAACCTGTTATCAGATCGTGGAGCACAGCTGGTTC[G/T]AGACCTTCATCATCTTCATGATCCTCCTCAGCAGCGGMGCTCTGGTACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2a6ojj99