ENSDARG00000087857

Ensembl ID:
ENSDARG00000087857
Human Orthologue:
RP1-239B22.1
Human Description:
Putative Ig-like domain-containing protein DKFZp686O24166/DKFZp686I21167 [Source:UniProtKB/Swiss-Pro

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41939 Nonsense Mutation detected in F1 DNA During 2017
sa38870 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41938 Nonsense Mutation detected in F1 DNA During 2017
sa35190 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41939
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128676 Nonsense 173 903 3 13
Genomic Location (Zv9):
Chromosome 12 (position 4702997)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3985719
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCAAGAACCTCAGAAGCTGCAAGTGAACCGGACGGAGGACGGACTTTA[T/A]GATGCCGTCAGTTTTCTGACATTCATCCCTCAAATCTCCAACCAGAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128676 Essential Splice Site 317 903 4 13
Genomic Location (Zv9):
Chromosome 12 (position 4700534)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3983256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGAACCTGCTAATGGAACCATTGACTTATCCACTGTTGACTTGCGTGG[T/G]ATGAACTCATTACTTCTTGTTACAGTGTTCGGTAACACTTTAGTTTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128676 Nonsense 402 903 6 13
Genomic Location (Zv9):
Chromosome 12 (position 4696583)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3979305
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGGCAGAAAGAGTTCAAACGACATGGTTTCTGAATGACATTCCCATC[A/T]AAGACACTTCGCACAAAGGTAACAACCACCCAAATTGTTGGTTGAATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128676 Nonsense 515 903 8 13
Genomic Location (Zv9):
Chromosome 12 (position 4692764)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3975486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTATTCCCTCTTTGTCTAGCACCACCTGAAGTGTCAGAGATCCAGTTCT[C/A]AGAGCCCAATGAGGAAGGAGGTATCGATCACAAACAGCACACGCATTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link