plekhn1

Ensembl ID:
ENSDARG00000087844
ZFIN ID:
ZDB-GENE-090313-357
Human Orthologue:
PLEKHN1
Human Description:
pleckstrin homology domain containing, family N member 1 [Source:HGNC Symbol;Acc:25284]
Mouse Orthologue:
Plekhn1
Mouse Description:
pleckstrin homology domain containing, family N member 1 Gene [Source:MGI Symbol;Acc:MGI:2387630]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45004 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43977 Essential Splice Site Mutation detected in F1 DNA During 2017
sa5977 Nonsense Mutation detected in F1 DNA During 2017
sa18011 Nonsense Available for shipment Available now
sa39408 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa45004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126479 Essential Splice Site 290 700 9 16

The following transcripts of ENSDARG00000087844 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 23539732)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACTGTGTGATGTACTCTGAATATAATCTTGCATGTATTTGAAATTACA[G/A]GGCAAACTTCCTCTCAATATGATCACAGTTACAACTCCCTGCCAGGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126479 Essential Splice Site 363 700 10 16

The following transcripts of ENSDARG00000087844 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 23540118)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23319425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCTCCTCCCCCCGTGTATGACATCATTTACACTCCAACACAGAAACAG[G/A]TGAGCGTTCACTTCCATCTTGGACAAGGTGTTGAGTATCTTTGATACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126479 Nonsense 439 700 12 16

The following transcripts of ENSDARG00000087844 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 23541922)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23321229
KASP Assay ID:
554-3781.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTACTCAGCTCATCTAGGCAGCAGGAGCAGCAGCTTCTCCTCTCGTGTC[A/T]GACCCGTTCCTGACCACCGTCCCATTTCACACCACTACCCCTCCCCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18011
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126479 Nonsense 591 700 14 16

The following transcripts of ENSDARG00000087844 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 23544505)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23323812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAAAAACAGACCYGGTCAGGCCCTSGAGCCCGAGGTCAACAGCGAGTG[G/A]TCAGATGAACTACGTGCCAGAGCYGTTTCTAAACTGAAGATAYTGCCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39408
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126479 Essential Splice Site 641 700 16 16

The following transcripts of ENSDARG00000087844 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 23546344)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23325651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAAACAGTAGTATTTGAAGCACTGAATGATTTTCTTTTGCTCCTCAC[A/T]GATGACTCTTACCTTCAGCCGGTGGAGCCAGATGACCTGGAAATGGACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link