ece1

Ensembl ID:
ENSDARG00000087841
Human Orthologue:
ECE2
Human Description:
endothelin converting enzyme 2 [Source:HGNC Symbol;Acc:13275]
Mouse Orthologue:
Ece2
Mouse Description:
endothelin converting enzyme 2 Gene [Source:MGI Symbol;Acc:MGI:1101356]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35796 Nonsense Mutation detected in F1 DNA During 2016
sa4586 Essential Splice Site F2 line generated During 2016
sa35795 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35796
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125867 Nonsense 305 767 7 18
Genomic Location (Zv9):
Chromosome 15 (position 4065477)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 4210787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTTGGGAGGAGACAAGAATTCCACTCGGGGTCAGATGCAGCAGATTT[T/A]GGACTTTGAGACGGCGCTGGCGAACATCACCGTGCCCCAGGACGAACGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4586
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125867 Essential Splice Site 460 767 10 18
Genomic Location (Zv9):
Chromosome 15 (position 4051962)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3987514
KASP Assay ID:
554-3569.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAGCTCTTTTCGTCAAAGCCACCTTCGACAAACAGAGCAAAGAAATAG[T/C]GAGTTGCTTCATGTGTCGTATTACAGTTGAAGTCAAATGTATTAGCCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35795
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125867 Essential Splice Site 493 767 11 18
Genomic Location (Zv9):
Chromosome 15 (position 4049867)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3985419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATTTGAAGTGGATGGATGAACAGACCCGACAAGCTGCCAAGGACAAG[G/A]TGAGAGAGAGAATGAGATTTGCAGCAGCATGACTGGATCACCAAAACTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link