bcl3

Ensembl ID:
ENSDARG00000087832
ZFIN ID:
ZDB-GENE-061013-1
Human Orthologue:
BCL3
Human Description:
B-cell CLL/lymphoma 3 [Source:HGNC Symbol;Acc:998]
Mouse Orthologue:
Bcl3
Mouse Description:
B-cell leukemia/lymphoma 3 Gene [Source:MGI Symbol;Acc:MGI:88140]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32090 Nonsense Available for shipment Available now
sa8983 Nonsense Mutation detected in F1 DNA During 2017
sa42728 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36138 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32090
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130641 Nonsense 250 619 3 9
Genomic Location (Zv9):
Chromosome 16 (position 27957910)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25803597
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAAATATTTCGATGTGCCCATAAAGACCTTGACATTTACAATAACCTA[C/T]GACAGGTAAAGTATAAACAATACAAGCAAACTTCGGGAGGTTGGCATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8983
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130641 Nonsense 344 619 5 9
Genomic Location (Zv9):
Chromosome 16 (position 27948141)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25793828
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTGTGCAGAATGGAGATCAGACGCTGACAGGAATCTTACTGGACAGC[G/T]GAGCTGAAATCAATGCTGGGGTCAGTCAATTCATCACCATATCATCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42728
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130641 Essential Splice Site 455 619 8 9
Genomic Location (Zv9):
Chromosome 16 (position 27942373)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25788060
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAAAGGCACTCGCAGCTTTACTGGGAAAACAATATCTAGCAGCAATGG[T/G]GAGTTCTTCTCTGAAAGTGCAAGAGTACATTTATTTCTAAACAAGGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36138
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130641 Nonsense 597 619 9 9
Genomic Location (Zv9):
Chromosome 16 (position 27941864)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25787551
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGCCGCATTTATCTCTCCACAGGGGACCATCAACCAATCACGGCCCT[C/A]AAGTCACAGCAGTGACCAATCAGACATATCTACTGTGAGTGTCAACAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link