GPR112 (2 of 2)

Ensembl ID:
ENSDARG00000087813
Description:
G protein-coupled receptor 112 [Source:HGNC Symbol;Acc:18992]
Human Orthologue:
GPR112
Human Description:
G protein-coupled receptor 112 [Source:HGNC Symbol;Acc:18992]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35712 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44809 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa28329 Nonsense Mutation detected in F1 DNA Unknown
sa22507 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35712
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128379 Essential Splice Site 467 1201 12 26
Genomic Location (Zv9):
Chromosome 14 (position 32601665)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 31391472
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACATGCAATTAAAAAAAGCTGCATTGTTACTCAAATGACATCTTTTTC[A/T]GGTACAAGACTACTTTTCAGGTCCAAGCATTGGCACCAGTGAATGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44809
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128379 Splice Site, Nonsense 559 1201 14 26
Genomic Location (Zv9):
Chromosome 14 (position 32604150)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGATGGATTTGCATTAATACATTGTGATGTTTTCTCATTCCATTCAG[T/A]AAATTAAACGGGGCAACTGACAAAGCTATTTGGGAGGCGCCAGATATGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128379 Nonsense 904 1201 22 26
Genomic Location (Zv9):
Chromosome 14 (position 32615528)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 31405335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTCTGTATTTTTCCTCACACATGTTGTTTTACCACAGGAAACTGAGA[C/T]GAGACTACCCTTCCAAGATCCTTATTAACCTCTGCATGGCCCTGCTAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22507
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128379 Nonsense 1056 1201 24 26
Genomic Location (Zv9):
Chromosome 14 (position 32618054)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 31407861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCCTGATCATGGTCTGTAATATCATCGTGTTTGTCGTGGTACTGGTA[C/T]AAATCCACAAAATGCGGGTCAACAAGCCTTCCAGCAGCAGAAAAGGGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link