LOC568833

Ensembl ID:
ENSDARG00000087805
Human Orthologue:
AC002365.2
Mouse Orthologues:
1700042B14Rik, 3110007F17Rik, 4930412D23Rik, 4930428D18Rik, 4930468A15Rik, AL805960.1, Gm16390, Gm2411, Gm4937, Gm5167, Gm6604
Mouse Descriptions:
predicted gene 16390 Gene [Source:MGI Symbol;Acc:MGI:3648403]
predicted gene 2411 Gene [Source:MGI Symbol;Acc:MGI:3809203]
predicted gene 4937 Gene [Source:MGI Symbol;Acc:MGI:3648293]
predicted gene 5167 Gene [Source:MGI Symbol;Acc:MGI:3645501]
predicted gene 6604 Gene [Source:MGI Symbol;Acc:MGI:3644765]
RIKEN cDNA 1700042B14 gene Gene [Source:MGI Symbol;Acc:MGI:1920597]
RIKEN cDNA 3110007F17 gene Gene [Source:MGI Symbol;Acc:MGI:1920311]
RIKEN cDNA 4930412D23 gene Gene [Source:MGI Symbol;Acc:MGI:1921184]
RIKEN cDNA 4930428D18 gene Gene [Source:MGI Symbol;Acc:MGI:3588232]
RIKEN cDNA 4930468A15 gene Gene [Source:MGI Symbol;Acc:MGI:1922237]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8235 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121492 Nonsense 34 241 1 1
Genomic Location:
Chromosome 6 (position 30154659)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTTTGTAGCATGGATAATGACGGCCTCTGTTTCTGGCGTGAACGACTG[G/A]AGGATTTGGTACGTAGACAATAYGACGGTCATCACCGGTGGAGTGGCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4c9wum1x