ENSDARG00000087793

Ensembl ID:
ENSDARG00000087793

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35892 Nonsense Mutation detected in F1 DNA During 2016
sa24987 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127571 Nonsense 119 465 6 9
Genomic Location:
Chromosome 15 (position 24916340)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCGAGCGTGATGTGTTTTTTTGACAGAATGGAGGCCTGGTGTTTCTGTA[T/A]CACCCGTGTGTCTCAGCGGAAGCTCGCAGGAGTCTGGCAGTGTTGGCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24987
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127571 Nonsense 310 465 8 9
Genomic Location:
Chromosome 15 (position 24912793)
KASP Assay ID:
554-7617.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGGAGCCTGAAAGAACTGCTACCAACCACACAAAAACAACTGCACAG[C/T]AGTTAAATATAGTCACTGAAAGACAAAAATACCAAACGAACAGAAAATCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link