LOC571439

Ensembl ID:
ENSDARG00000087780
Human Orthologue:
TIAM2
Human Description:
T-cell lymphoma invasion and metastasis 2 [Source:HGNC Symbol;Acc:11806]
Mouse Orthologue:
Tiam2
Mouse Description:
T-cell lymphoma invasion and metastasis 2 Gene [Source:MGI Symbol;Acc:MGI:1344338]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23184 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10201 Essential Splice Site Available for shipment Available now
sa36526 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23184
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130685 Essential Splice Site 1107 1677 19 31
Genomic Location (Zv9):
Chromosome 17 (position 49345939)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49107023
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGCAAGGTCATCCAGGAATTAGTGGATACAGAGAAATCCTACGTAAAG[G/A]TGAGAACCGACTCCATAATCCCCTATTAACATCGTTCAACAGAGCGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10201
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130685 Essential Splice Site 1107 1677 19 31
Genomic Location (Zv9):
Chromosome 17 (position 49345940)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49107024
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCAAGGTCATCCAGGAATTAGTGGATACAGAGAAATCCTACGTAAAGG[T/C]GAGAACCGACTCCATAATCCCCTATTAACATCGTTCAACAGAGCRAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36526
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130685 Essential Splice Site 1397 1677 28 31
Genomic Location (Zv9):
Chromosome 17 (position 49368183)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49129267
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCTCATTCCCCTGTCAGCGCTACAGGTCAGACTGGGCAACACTGCAG[G/A]TAAGAGACGCATCTGGCATGTTTGAGTTTATAGAGATGCTAGTAATCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link