LOC571439

Ensembl ID:
ENSDARG00000087780
Human Orthologue:
TIAM2
Human Description:
T-cell lymphoma invasion and metastasis 2 [Source:HGNC Symbol;Acc:11806]
Mouse Orthologue:
Tiam2
Mouse Description:
T-cell lymphoma invasion and metastasis 2 Gene [Source:MGI Symbol;Acc:MGI:1344338]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23184 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10201 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23184
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130685 Essential Splice Site 1107 1677 19 31
Genomic Location:
Chromosome 17 (position 49345939)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGCAAGGTCATCCAGGAATTAGTGGATACAGAGAAATCCTACGTAAAG[G/A]TGAGAACCGACTCCATAATCCCCTATTAACATCGTTCAACAGAGCGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10201
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130685 Essential Splice Site 1107 1677 19 31
Genomic Location:
Chromosome 17 (position 49345940)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCAAGGTCATCCAGGAATTAGTGGATACAGAGAAATCCTACGTAAAGG[T/C]GAGAACCGACTCCATAATCCCCTATTAACATCGTTCAACAGAGCRAAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/utqlcyhv