ENSDARG00000087768

Ensembl ID:
ENSDARG00000087768
Human Orthologue:
EXT1
Human Description:
exostosin 1 [Source:HGNC Symbol;Acc:3512]
Mouse Orthologue:
Ext1
Mouse Description:
exostoses (multiple) 1 Gene [Source:MGI Symbol;Acc:MGI:894663]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17041 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17041
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122019 Nonsense 111 320 1 1
Genomic Location:
Chromosome 20 (position 3475423)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGCCGCAGATGCCGCATGGACACCTGCTTTGACTTTCAGCGATGTGAA[C/T]GAGGGTTTAAAATCTACGTGTATCCACCTCAGAAAGGCGAAGTGCCCTCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ohcr37hg