PSMD2 (2 of 2)

Ensembl ID:
ENSDARG00000087758
Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 [Source:HGNC Symbol;Acc:9559]
Human Orthologue:
PSMD2
Human Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 [Source:HGNC Symbol;Acc:9559]
Mouse Orthologue:
Psmd2
Mouse Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 2 Gene [Source:MGI Symbol;Acc:MGI:1096584]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5884 Nonsense Mutation detected in F1 DNA During 2017
sa22730 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123899 Nonsense 109 396 3 7
Genomic Location (Zv9):
Chromosome 15 (position 44262225)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150158.1 9160
KASP Assay ID:
554-3894.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAGGTTGTGCTTTTGTTTTGTTTGTCAGGAGAAGGACACGTCTCTGTA[T/A]CGTCCCGCTCTGGAGGAACTGCGGCGTCAGATTCGCTCCTCCACAACKTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22730
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123899 Nonsense 212 396 5 7
Genomic Location (Zv9):
Chromosome 15 (position 44258287)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150158.1 5222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTCAGGCATCTTGCAGGAGAAGTGGCTAAAGAATGGCAGGAGATC[G/T]AGGAAGGGGATAAAGCTCAACAGGAAGTCCTTCTGAAGCTTGTCAAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link