ENSDARG00000087756

Ensembl ID:
ENSDARG00000087756
Human Orthologue:
CA4
Human Description:
carbonic anhydrase IV [Source:HGNC Symbol;Acc:1375]
Mouse Orthologue:
Car4
Mouse Description:
carbonic anhydrase 4 Gene [Source:MGI Symbol;Acc:MGI:1096574]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18357 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18357
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122632 Nonsense 232 273 8 9
ENSDART00000129502 Nonsense 242 260 7 7
Genomic Location:
Chromosome 12 (position 5042668)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTNTTTTGTTTTCTGAAGCTGCTCAGATTCCAGACGGTTTCTTTTGGCTA[T/A]GTTTATCGGCCRCAGCAATCTCTGAACAAGCGMACGGTTTATGCTTCGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lyaamwxb