LOC100329327

Ensembl ID:
ENSDARG00000087752
Human Orthologue:
RFWD3
Human Description:
ring finger and WD repeat domain 3 [Source:HGNC Symbol;Acc:25539]
Mouse Orthologue:
Rfwd3
Mouse Description:
ring finger and WD repeat domain 3 Gene [Source:MGI Symbol;Acc:MGI:2384584]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31117 Nonsense Mutation detected in F1 DNA During 2017
sa39496 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131076 Nonsense 230 632 6 12
Genomic Location (Zv9):
Chromosome 25 (position 38332648)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36685041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGATGATGTTTATGTTGCTGGTTGTGTGCAGTCGTCTGGAGCTGGAG[C/T]AGGGCTCTCGCAGGATGGAGCAGCTGGAGGTGGCTCAGTGTCGGCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39496
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131076 Nonsense 449 632 10 12
Genomic Location (Zv9):
Chromosome 25 (position 38336201)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 36681488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGTGTGTGTTCCTCAGCTGTCCGGTGGTGTCTCTCTCCTA[C/A]ATCCCGCACTCCTCCACCTCTTCCTCCTTTCCGTGTGGAGGTGTGATCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link