FAM190B (1 of 2)

Ensembl ID:
ENSDARG00000087749
Description:
family with sequence similarity 190, member B [Source:HGNC Symbol;Acc:29197]
Human Orthologue:
FAM190B
Human Description:
family with sequence similarity 190, member B [Source:HGNC Symbol;Acc:29197]
Mouse Orthologue:
Gcap14
Mouse Description:
granule cell antiserum positive 14 Gene [Source:MGI Symbol;Acc:MGI:101859]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28865 Nonsense Mutation detected in F1 DNA During 2017
sa36424 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28865
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122366 Nonsense 465 802 3 11
Genomic Location (Zv9):
Chromosome 17 (position 26358593)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26498512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGTAGATCCTGATGTGTGTTTAATTTTTAGGTGGTAAGGCAGATTTA[C/T]AGAGTGCTCCACTACGTGGTCCACCGCTCATGTCTCCTGAAGTGGACCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122366 Nonsense 785 802 11 11
Genomic Location (Zv9):
Chromosome 17 (position 26323528)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 26463447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCATCTTCCACAGCCTCAAATACTTCAGCCCATCAGTCGCATCCCCAA[C/T]GAGCCCCTCATCCAGGGAAAACTAGCAAGAACAGTCCCAATCGGGGGCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link