MAP4K3 (1 of 2)

Ensembl ID:
ENSDARG00000087742
Description:
mitogen-activated protein kinase kinase kinase kinase 3 [Source:HGNC Symbol;Acc:6865]
Human Orthologue:
MAP4K3
Human Description:
mitogen-activated protein kinase kinase kinase kinase 3 [Source:HGNC Symbol;Acc:6865]
Mouse Orthologue:
Map4k3
Mouse Description:
mitogen-activated protein kinase kinase kinase kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2154405]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11669 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11669
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101667 Nonsense 195 903 9 34
Genomic Location:
Chromosome 11 (position 31315009)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCAGAAGTTGCTGCTGTGGAGAGGAAAGGAGGCTACAATCATYTGWG[T/A]GATATCTGGGCTGTCGGCAKCACTGCCATTGAACTAGCTGAACTGCAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h7le32l2