MAP4K3 (1 of 2)

Ensembl ID:
ENSDARG00000087742
Description:
mitogen-activated protein kinase kinase kinase kinase 3 [Source:HGNC Symbol;Acc:6865]
Human Orthologue:
MAP4K3
Human Description:
mitogen-activated protein kinase kinase kinase kinase 3 [Source:HGNC Symbol;Acc:6865]
Mouse Orthologue:
Map4k3
Mouse Description:
mitogen-activated protein kinase kinase kinase kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2154405]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35117 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11669 Nonsense Available for shipment Available now
sa38850 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101667 Essential Splice Site 104 903 4 34
Genomic Location (Zv9):
Chromosome 11 (position 31325024)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30202386
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATCCATGGAATACTGTGGAGGAGGTTCGCTGCAAGACATATATCACGG[T/A]AAGTTACACCGCACAAAGGTAAACAATCAACTGCAGCGCTAACTCAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11669
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101667 Nonsense 195 903 9 34
Genomic Location (Zv9):
Chromosome 11 (position 31315009)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30192371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCAGAAGTTGCTGCTGTGGAGAGGAAAGGAGGCTACAATCATYTGWG[T/A]GATATCTGGGCTGTCGGCAKCACTGCCATTGAACTAGCTGAACTGCAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38850
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101667 Essential Splice Site 668 903 26 34
Genomic Location (Zv9):
Chromosome 11 (position 31254907)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30132269
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCTGTTTCCATCCCGACACACAAACTGCCTGACAAAATGATTCCCAGG[T/C]GAATGTTTGCATCAGTCAAGATGTGGCCAGTTCTTAAAATGTTCATATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link