NLRX1 (24 of 33)

Ensembl ID:
ENSDARG00000087736
Description:
NLR family member X1 [Source:HGNC Symbol;Acc:29890]
Human Orthologue:
NLRX1
Human Description:
NLR family member X1 [Source:HGNC Symbol;Acc:29890]
Mouse Orthologue:
Nlrx1
Mouse Description:
NLR family member X1 Gene [Source:MGI Symbol;Acc:MGI:2429611]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42564 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42564
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122159 Nonsense 341 887 1 7
Genomic Location (Zv9):
Chromosome 15 (position 27705780)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28424020
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCAGCCAGTATTACAGCCTGTTGGGTTTCTCTGTAGATCAGCAGAAG[C/T]AGTACTTTGAGAAGAACTGCAGATCTCCTGAGGCTGCTGCTGCAGTTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link