LOC569688

Ensembl ID:
ENSDARG00000087717
Human Orthologue:
TMPRSS5
Human Description:
transmembrane protease, serine 5 [Source:HGNC Symbol;Acc:14908]
Mouse Orthologue:
Tmprss5
Mouse Description:
transmembrane protease, serine 5 (spinesin) Gene [Source:MGI Symbol;Acc:MGI:1933407]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42520 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42520
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129528 Essential Splice Site 141 390 4 10
Genomic Location (Zv9):
Chromosome 15 (position 17112674)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 18233047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGGGGAAGCTGTAGTACAGGAAAGGTTATAGCACTAAAATGTTTTGG[T/C]GAGCCTACTTTTAACTTAATCCTGAAATAAGAGATAATATCCACATACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link