ENSDARG00000087700

Ensembl ID:
ENSDARG00000087700

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20306 Nonsense Mutation detected in F1 DNA During 2016
sa40322 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20306
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125717 Nonsense 509 765 4 4
Genomic Location (Zv9):
Chromosome 4 (position 38061343)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 37725545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGATGTTCACATGAGAGTTCACACTAGGGAGCAACTTTTCACCTGCGAA[C/T]AGTGTGGAAAGAGTTTTGGTCAAAAACAAAGCTTTAAAGCCCACATGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125717 Nonsense 628 765 4 4
Genomic Location (Zv9):
Chromosome 4 (position 38060986)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 30567985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACAGGGGAGAAACCTTACACCTGCGAACAGTGTGGAAAGAGTTTTAGT[C/T]AAAAACGAAGCTTTAAAGCCCACATGAGAATTCACACTGGAGAGAGGCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link