KLHL29 (1 of 2)

Ensembl ID:
ENSDARG00000087688
Description:
kelch-like 29 (Drosophila) [Source:HGNC Symbol;Acc:29404]
Human Orthologue:
KLHL29
Human Description:
kelch-like 29 (Drosophila) [Source:HGNC Symbol;Acc:29404]
Mouse Orthologue:
Klhl29
Mouse Description:
kelch-like 29 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2683857]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39305 Nonsense Mutation detected in F1 DNA During 2016
sa23797 Nonsense Available for shipment Available now
sa37145 Nonsense Mutation detected in F1 DNA During 2016
sa11650 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124298 Nonsense 497 869 6 12
Genomic Location:
Chromosome 20 (position 45144634)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGACAGCCTGAACACCAAGGCAGAGGAGCTGGTTTATGAGACTGTCATC[A/T]AATGGATCAAGAAGGACCCCATCAACAGAGTACAGGTGAGAAGTGCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23797
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124298 Nonsense 508 869 6 12
Genomic Location:
Chromosome 20 (position 45144601)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATGAGACTGTCATCAAATGGATCAAGAAGGACCCCATCAACAGAGTA[C/T]AGGTGAGAAGTGCATTCGCCGCATGAAACATATGCCAGAGTAATGGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37145
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124298 Nonsense 513 869 7 12
Genomic Location:
Chromosome 20 (position 45110041)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGCTGAATATATATTCTCTCTCTTTTTCTCGCAGCACATATCAGAGT[T/A]GCTGGCTGTGGTCAGGCTTCCATTTATCCACCCCAGTTACCTGCTGAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11650
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124298 Nonsense 539 869 7 12
Genomic Location:
Chromosome 20 (position 45109963)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACCCYAGTTACCTGCTGAACGTGGTGGACAATGAGGAGTTGATTAAAT[C/A]GTCGGAGGCTTGCCGAGACCTRGTGAATGAGGCCAAACGATACCACATGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link