KLHL29 (1 of 2)

Ensembl ID:
ENSDARG00000087688
Description:
kelch-like 29 (Drosophila) [Source:HGNC Symbol;Acc:29404]
Human Orthologue:
KLHL29
Human Description:
kelch-like 29 (Drosophila) [Source:HGNC Symbol;Acc:29404]
Mouse Orthologue:
Klhl29
Mouse Description:
kelch-like 29 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2683857]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23797 Nonsense Mutation detected in F1 DNA During 2014
sa11650 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23797
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124298 Nonsense 508 869 6 12
Genomic Location:
Chromosome 20 (position 45144601)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATGAGACTGTCATCAAATGGATCAAGAAGGACCCCATCAACAGAGTA[C/T]AGGTGAGAAGTGCATTCGCCGCATGAAACATATGCCAGAGTAATGGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11650
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124298 Nonsense 539 869 7 12
Genomic Location:
Chromosome 20 (position 45109963)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACCCYAGTTACCTGCTGAACGTGGTGGACAATGAGGAGTTGATTAAAT[C/A]GTCGGAGGCTTGCCGAGACCTRGTGAATGAGGCCAAACGATACCACATGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/clnmx7d2