si:dkey-1c11.1

Ensembl ID:
ENSDARG00000087681
ZFIN ID:
ZDB-GENE-081104-352
Human Orthologue:
C1orf187
Human Description:
chromosome 1 open reading frame 187 [Source:HGNC Symbol;Acc:25054]
Mouse Orthologue:
2610109H07Rik
Mouse Description:
RIKEN cDNA 2610109H07 gene Gene [Source:MGI Symbol;Acc:MGI:1917683]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24313 Nonsense Available for shipment Available now
sa37690 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24313
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125336 Nonsense 237 349 3 6
ENSDART00000144320 Nonsense 237 349 4 7
Genomic Location (Zv9):
Chromosome 23 (position 21778777)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21558084
KASP Assay ID:
2261-7642.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGATGTGGCGCCCACTTTTAACATGGCCTTATTTGACTGGACGGATTA[T/A]GAAGATATGAGGCCTGGAGATAAAAAGCAATATTCGAAAAAGCAAGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37690
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125336 Nonsense 248 349 3 6
ENSDART00000144320 Nonsense 248 349 4 7
Genomic Location (Zv9):
Chromosome 23 (position 21778810)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21558117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGACTGGACGGATTATGAAGATATGAGGCCTGGAGATAAAAAGCAATA[T/G]TCGAAAAAGCAAGGTGAACCAATATTGCACATACAATACATTTATTCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link