C16orf11

Ensembl ID:
ENSDARG00000087663
Description:
chromosome 16 open reading frame 11 [Source:HGNC Symbol;Acc:14139]
Human Orthologue:
C16orf11
Human Description:
chromosome 16 open reading frame 11 [Source:HGNC Symbol;Acc:14139]
Mouse Orthologues:
A930017K11Rik, Nhlrc4
Mouse Descriptions:
NHL repeat containing 4 Gene [Source:MGI Symbol;Acc:MGI:3687200]
RIKEN cDNA A930017K11 gene Gene [Source:MGI Symbol;Acc:MGI:2442713]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16751 Nonsense Available for shipment Available now
sa11215 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16751
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128747 Nonsense 228 634 1 2
Genomic Location:
Chromosome 24 (position 39506104)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCGGCTCCRTCGCTACCCTGCTATCCTCCGGTCTCAACGAGTCAAATC[G/T]AATGCTCAGATCCACCAGCGTTCAATCTGTCTTTACTYGGTGTGGGTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11215
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128747 Nonsense 282 634 1 2
Genomic Location:
Chromosome 24 (position 39505941)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCACCTCTACCATTCCTAGCATCACAGCTAGCGCACTCRCAGAGACACT[C/A]GGAGCGTTCTCTACTCCCTCCGCATCTGTATTATCCGTTCTTGTGCGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x54bngm7