PCMTD2 (1 of 2)

Ensembl ID:
ENSDARG00000087644
Description:
protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 [Source:HGNC Symbol;Acc
Human Orthologue:
PCMTD2
Human Description:
protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 [Source:HGNC Symbol;Acc
Mouse Orthologue:
Pcmtd2
Mouse Description:
protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 Gene [Source:MGI Symbol

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24257 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24257
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129279 Nonsense 159 395 3 5
Genomic Location (Zv9):
Chromosome 23 (position 7835723)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 7812600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCAACCTTTGTTGTGGGGAACTGTCTGGAGATTCCTCCGGAGAGCCGG[C/T]AGTATGACAGGGTTTACTGCGGTGCAGGAGTTCAGAAAGAGTATGAGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link