LOC569427

Ensembl ID:
ENSDARG00000087625
Human Orthologue:
OLFM4
Human Description:
olfactomedin 4 [Source:HGNC Symbol;Acc:17190]
Mouse Orthologues:
E030002O03Rik, Olfm4
Mouse Descriptions:
olfactomedin 4 Gene [Source:MGI Symbol;Acc:MGI:2685142]
RIKEN cDNA E030002O03 gene Gene [Source:MGI Symbol;Acc:MGI:2443346]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23196 Essential Splice Site Mutation detected in F1 DNA During 2016
sa4731 Nonsense Mutation detected in F1 DNA During 2016
sa36545 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127225 Essential Splice Site 19 466 2 5
Genomic Location:
Chromosome 17 (position 53123353)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGAAGACATTATGAGTAGAAAGGTTGATGTTTTCCCTTGTGTCCTGCA[G/A]GCAGTGAGCCTCTGGGCTGAAGGCAGTGCCTCCAGTGGAGAGTGCATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127225 Nonsense 159 466 4 5
Genomic Location:
Chromosome 17 (position 53122036)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTATGATTTCTGTGCTGACTCAACTGGAGATCACCTAYGACAAGAACT[T/A]GGTTCTCGTGACCCGCCGAGAATATTTAATTCTTCAGCAGAAACTGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36545
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127225 Nonsense 363 466 5 5
Genomic Location:
Chromosome 17 (position 53118501)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGGCGGACTCGAAGGGTAAACTAGTCCTAGGGAAGATCAATGAACAGT[C/A]ATTCGCAGTCGAGACGGTCTTTCAGACCAGTGTTTATAAACCCTCTGTCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link