LOC569427

Ensembl ID:
ENSDARG00000087625
Human Orthologue:
OLFM4
Human Description:
olfactomedin 4 [Source:HGNC Symbol;Acc:17190]
Mouse Orthologues:
E030002O03Rik, Olfm4
Mouse Descriptions:
olfactomedin 4 Gene [Source:MGI Symbol;Acc:MGI:2685142]
RIKEN cDNA E030002O03 gene Gene [Source:MGI Symbol;Acc:MGI:2443346]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23196 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4731 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127225 Essential Splice Site 19 466 2 5
Genomic Location:
Chromosome 17 (position 53123353)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGAAGACATTATGAGTAGAAAGGTTGATGTTTTCCCTTGTGTCCTGCA[G/A]GCAGTGAGCCTCTGGGCTGAAGGCAGTGCCTCCAGTGGAGAGTGCATCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4731
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127225 Nonsense 159 466 4 5
Genomic Location:
Chromosome 17 (position 53122036)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTATGATTTCTGTGCTGACTCAACTGGAGATCACCTAYGACAAGAACT[T/A]GGTTCTCGTGACCCGCCGAGAATATTTAATTCTTCAGCAGAAACTGGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/603qbdi8