MAPT (2 of 2)

Ensembl ID:
ENSDARG00000087616
Description:
microtubule-associated protein tau [Source:HGNC Symbol;Acc:6893]
Human Orthologue:
MAPT
Human Description:
microtubule-associated protein tau [Source:HGNC Symbol;Acc:6893]
Mouse Orthologue:
Mapt
Mouse Description:
microtubule-associated protein tau Gene [Source:MGI Symbol;Acc:MGI:97180]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33151 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40055 Nonsense Mutation detected in F1 DNA During 2016
sa30832 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33151
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130546 Essential Splice Site 618 752 8 11
Genomic Location (Zv9):
Chromosome 3 (position 22385729)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 22042120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAGATCGGCTCCACTGAGAACCTCAAACACCAACCTGGAGGCGGGAAG[G/A]TAGTTATGTCATGCATGTCAGAAAATTGGGACACAATTAATCTAAAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130546 Nonsense 633 752 9 11
ENSDART00000130546 Nonsense 633 752 9 11
Genomic Location (Zv9):
Chromosome 3 (position 22381674)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 22038065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTCAGATTCAGATTGTGCACAAAAAGATCGACCTAAGCAACGTCCAGT[C/A]AAAGTGCGGCTCCAAGGCCAACATTCATCACAAACCGGGTGAGATTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130546 Nonsense 633 752 9 11
ENSDART00000130546 Nonsense 633 752 9 11
Genomic Location (Zv9):
Chromosome 3 (position 22381674)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 22038065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTCAGATTCAGATTGTGCACAAAAAGATCGACCTAAGCAACGTCCAGT[C/A]AAAGTGCGGCTCCAAGGCCAACATTCATCACAAACCGGGTGAGATTTCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link