ENSDARG00000087601

Ensembl ID:
ENSDARG00000087601
Human Orthologues:
GPR153, GPR162
Human Descriptions:
G protein-coupled receptor 153 [Source:HGNC Symbol;Acc:23618]
G protein-coupled receptor 162 [Source:HGNC Symbol;Acc:16693]
Mouse Orthologues:
Gpr153, Gpr162
Mouse Descriptions:
G protein-coupled receptor 153 Gene [Source:MGI Symbol;Acc:MGI:1916157]
G protein-coupled receptor 162 Gene [Source:MGI Symbol;Acc:MGI:1315214]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25406 Nonsense Mutation detected in F1 DNA During 2014
sa21377 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25406
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121496 Nonsense 317 364 3 3
Genomic Location:
Chromosome 8 (position 48775766)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCATTGGGTGCACGGACCGGGGATCAATCTTCTCCAAGTATTAGGACA[G/T]GACAGGTAAACGCATCTGCTTGGGTGGACCACAAACACCTGTCAAAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21377
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121496 Nonsense 346 364 3 3
Genomic Location:
Chromosome 8 (position 48775853)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGTCAAAAGGTGAAAGCAAAGGAAGCACAAATAGTTTTATAAGCTCA[C/T]AATCTGCATCGTCCGGCTATATCACTTTTCACTCGGAATCCATAGGATCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ugys1cka