ENSDARG00000087600

Ensembl ID:
ENSDARG00000087600
Human Orthologue:
SBNO2
Human Description:
strawberry notch homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:29158]
Mouse Orthologue:
Sbno2
Mouse Description:
strawberry notch homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2448490]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6023 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125202 Nonsense 300 541 5 5
Genomic Location:
Chromosome 2 (position 57538717)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAAACGTTCGATCTTGAGGACCTGATTTCCCAGGAGCAGCAGAGACAC[C/T]GACAGGTGGTGTTAAACTCAAACATGCGCATGCCGTCATCGCATTCGTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w18xy7dk