ENSDARG00000087596

Ensembl ID:
ENSDARG00000087596

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39064 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32054 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39064
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130129 Essential Splice Site 540 807 5 9
Genomic Location (Zv9):
Chromosome 15 (position 34275894)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35121670
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATTATGAATGCACATGCACATTATCCTTCATTTCTGTGTTTTTAAATC[A/C]GACGGTTTTGGAGGCTCAGCTGTCTGAGGCGAGCGAGAGAGAGAAAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32054
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130129 Nonsense 627 807 6 9
Genomic Location (Zv9):
Chromosome 15 (position 34278759)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35124535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGTGGAAAGAGCGAGATTCAGCCCTGACTGCACTGGTGCAGGACAAC[A/T]AAGACTACATTTCCCAGTTAAAGGAGGCGCTTGAGAGTTCACGCAGAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link