LOC555278

Ensembl ID:
ENSDARG00000087575
Mouse Orthologues:
Gm4070, Gvin1
Mouse Descriptions:
GTPase, very large interferon inducible 1 Gene [Source:MGI Symbol;Acc:MGI:1921808]
predicted gene 4070 Gene [Source:MGI Symbol;Acc:MGI:3782245]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9401 Nonsense Mutation detected in F1 DNA During 2014
sa16428 Nonsense Available for shipment Available now
sa16488 Nonsense Available for shipment Available now
sa17330 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9401
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126148 Nonsense 149 875 1 2
Genomic Location:
Chromosome 3 (position 24947265)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATGGACATTCAGATGGCTGTGTTTCTCAATGCGGACAATTTCCTTCGG[C/T]AGCTCATAGTAACAAAACTCTCACAGTGTCAGTATGCTCTTCCTCTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16428
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126148 Nonsense 516 875 1 2
ENSDART00000126148 Nonsense 516 875 1 2
Genomic Location:
Chromosome 3 (position 24948366)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCCTTCTGGATGAGTTCACTTCAGAAGATCTCTGCAAGCTCCATCAC[G/T]AGTATGATGAAACATGGTCAAAAGTGCTGGATTTGAAAAAGAAACACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16488
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126148 Nonsense 516 875 1 2
ENSDART00000126148 Nonsense 516 875 1 2
Genomic Location:
Chromosome 3 (position 24948366)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATCCTTCTGGATGAGTTCACTTCAGAAGATCTCTGCAAGCTCCATCAC[G/T]AGTATGATGAAACATGGTCAAAAGTGCTGGATTTGAAAAAGAAACACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17330
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126148 Nonsense 697 875 1 2
Genomic Location:
Chromosome 3 (position 24948909)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAACTGAAAAGCCAGTTAAACTTTGACTACATTCTTGTTGTTGATACM[G/T]AGGGCCTTCGAGCTCTAGAACTGGCTGGCAGATCAACTAGACAKCATGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cgb2sjf6