CLCA1

Ensembl ID:
ENSDARG00000087565
Description:
chloride channel accessory 1 [Source:HGNC Symbol;Acc:2015]
Human Orthologue:
CLCA1
Human Description:
chloride channel accessory 1 [Source:HGNC Symbol;Acc:2015]
Mouse Orthologue:
Clca3
Mouse Description:
chloride channel calcium activated 3 Gene [Source:MGI Symbol;Acc:MGI:1346342]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32021 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32021
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130524 Nonsense 123 377 2 5
Genomic Location (Zv9):
Chromosome 15 (position 14027326)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14234385
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGAACCAACAGTTTAGCGATGGCAGTAAACCCATGATAGTGTTTGCT[G/T]AAGTAGTTCAGAATTACAAGCCTCTCATAAAGGCAGAAGTGTGGGCTACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link