NOX4 (1 of 3)

Ensembl ID:
ENSDARG00000087563
Description:
NADPH oxidase 4 [Source:HGNC Symbol;Acc:7891]
Human Orthologue:
NOX4
Human Description:
NADPH oxidase 4 [Source:HGNC Symbol;Acc:7891]
Mouse Orthologue:
Nox4
Mouse Description:
NADPH oxidase 4 Gene [Source:MGI Symbol;Acc:MGI:1354184]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42623 Nonsense Mutation detected in F1 DNA During 2017
sa42622 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42623
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126310 Nonsense 55 85 3 3
Genomic Location (Zv9):
Chromosome 15 (position 42601686)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43805417
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGATGGAGTAAGTGCTGTTGTGTGTTGCAGTGACGACTGGTGCCATTA[T/A]AAGCTGAAGCGGCTGTATTTCGTGTGGATCTGCAGAGACATACAGTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42622
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126310 Nonsense 83 85 3 3
Genomic Location (Zv9):
Chromosome 15 (position 42601602)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43805333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGACATACAGTGCTTCTACTGGTTTGCTGATCTACTGTGTGGCCTTTA[T/A]GAGAGGGTAAAAAACACACACACACACACACACACTCACACACACACACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link