si:ch73-105b23.1

Ensembl ID:
ENSDARG00000087558
ZFIN ID:
ZDB-GENE-081107-41
Description:
Novel EGF domain containing protein [Source:UniProtKB/TrEMBL;Acc:B8JM10]
Human Orthologue:
LTBP3
Human Description:
latent transforming growth factor beta binding protein 3 [Source:HGNC Symbol;Acc:6716]
Mouse Orthologue:
Ltbp3
Mouse Description:
latent transforming growth factor beta binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:1101355]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28065 Nonsense Mutation detected in F1 DNA During 2017
sa18341 Nonsense Available for shipment Available now
sa1273 Nonsense Available for shipment Available now
sa22224 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa28065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123587 Nonsense 270 1315 1 3
Genomic Location (Zv9):
Chromosome 13 (position 8194044)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8496564
KASP Assay ID:
2260-6053.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTTCATTCTTCTGTGACTGTGGTCAAGGGTATAACTTTACTCAAAAT[C/T]AGTGTGTAGATTTGGATGAATGTGCCATAGGACTTTGCAGTCCTTATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18341
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123587 Nonsense 304 1315 1 3
Genomic Location (Zv9):
Chromosome 13 (position 8193942)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8496462
KASP Assay ID:
2260-6052.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGTGAAAACATGCCTGGTTCWTACAAATGCTCGTGCATAGCTGGTTTC[A/T]AAGGTGATGGRCTTGTATGCGAAGACGTGGATGAGTGCRTCACAGAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1273
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123587 Nonsense 447 1315 1 3
Genomic Location (Zv9):
Chromosome 13 (position 8193511)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8496031
KASP Assay ID:
554-1188.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGATGACTTCTGCTCTGATATTAACGAATGTGACATTCAGAAACCTTG[T/A]CATCAAAATGCCACATGCTTGAATTTGGTAGGCTCCTACTCATGTACCTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa22224
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123587 Nonsense 718 1315 3 3
Genomic Location (Zv9):
Chromosome 13 (position 8192442)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8494962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCAAGTGCACCTGTCCGCTTGGCATGACCGGGTCTGGGTTTGATTGT[C/T]AGGATGTGGACGAATGCAACGCAAACTCAACTTTGCCTCATAACTGCAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link