kif3a

Ensembl ID:
ENSDARG00000087538
ZFIN ID:
ZDB-GENE-050417-71
Description:
Kif3a proteinKinesin family member 3A [Source:UniProtKB/TrEMBL;Acc:Q568I3]
Human Orthologue:
KIF3A
Human Description:
kinesin family member 3A [Source:HGNC Symbol;Acc:6319]
Mouse Orthologue:
Kif3a
Mouse Description:
kinesin family member 3A Gene [Source:MGI Symbol;Acc:MGI:107689]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1617 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1617
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123338 Nonsense 409 701 9 17
ENSDART00000124944 None None 219 None 5
Genomic Location:
Chromosome 14 (position 24886891)
KASP Assay ID:
554-1558.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATATGGATGAAGATGATGTTGGAGATGGAGGAGAGAGGCGCAGGAAA[C/T]GAAGAGGTATAAATCGTCTGTTTTCATTTCATGACAGGTCAGCATTAGTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Atopic dermatitis: Genome-wide association study identifies eight new susceptibility loci for atopic dermatitis in the Japanese population. (View Study)
  • Atopic dermatitis: Meta-analysis of genome-wide association studies identifies three new risk loci for atopic dermatitis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/95ywwhog