LOC100151213

Ensembl ID:
ENSDARG00000087536
Human Orthologue:
ZNF407
Human Description:
zinc finger protein 407 [Source:HGNC Symbol;Acc:19904]
Mouse Orthologue:
Zfp407
Mouse Description:
zinc finger protein 407 Gene [Source:MGI Symbol;Acc:MGI:2685179]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13348 Nonsense Available for shipment Available now
sa19130 Nonsense Mutation detected in F1 DNA During 2014
sa10913 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13348
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124065 Nonsense 137 1389 1 8
Genomic Location:
Chromosome 16 (position 7946877)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAGGTGCATCTGGAGAGTTCTTCAGTGTCTCTGTCAGAAGAGGACAAA[C/T]AATCGGATTGCTGCGTGGATGAAAACTCKGTGAAGGTTGTTGGAAACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19130
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124065 Nonsense 623 1389 1 8
ENSDART00000124065 Nonsense 623 1389 1 8
Genomic Location:
Chromosome 16 (position 7948335)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGTGAGGAGAATTGTAATAACGAGAATGGAGAAAAGCAGTCTGACGAA[C/T]AGAGTACCTCTAAAGATAACGAAGAATCAGATCCAACCGTTTCTGATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124065 Nonsense 623 1389 1 8
ENSDART00000124065 Nonsense 623 1389 1 8
Genomic Location:
Chromosome 16 (position 7948335)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAARTGAGGAGAATTGTAATAACGAGAATGGAGAAAAGCAGTCTGACGAA[C/T]AGAGTACCTCTAAAGATAACGAAGAATCAGATCCAACCGTTTCTGATGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Testosterone levels: Genome-wide association study of circulating estradiol, testosterone, and sex hormone-binding globulin in postmenopausal women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ioatmsh7