si:ch211-278p9.1

Ensembl ID:
ENSDARG00000087532
ZFIN ID:
ZDB-GENE-081028-46
Human Orthologue:
NLRC5
Human Description:
NLR family, CARD domain containing 5 [Source:HGNC Symbol;Acc:29933]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22997 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22997
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105963 Nonsense 542 1120 3 8
ENSDART00000144492 Nonsense 422 477 1 1
Genomic Location (Zv9):
Chromosome 17 (position 7291976)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 7294750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCACTGAGATCTTTAAGGAGGAATCTGTGATTCATCAGAGGAAAGTCTA[C/A]AGCTTCATTCATTTGAGCTTTCAAGAATTTCTCGCTGCTCTATTTCTGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)
  • Schizophrenia: Genome-wide association study of clinical dimensions of schizophrenia: polygenic effect on disorganized symptoms. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link