ENSDARG00000087520

Ensembl ID:
ENSDARG00000087520
Human Orthologues:
SLC47A1, SLC47A2
Human Descriptions:
solute carrier family 47, member 1 [Source:HGNC Symbol;Acc:25588]
solute carrier family 47, member 2 [Source:HGNC Symbol;Acc:26439]
Mouse Orthologues:
Slc47a1, Slc47a2
Mouse Descriptions:
solute carrier family 47, member 1 Gene [Source:MGI Symbol;Acc:MGI:1914723]
solute carrier family 47, member 2 Gene [Source:MGI Symbol;Acc:MGI:3588190]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38190 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124007 Essential Splice Site 383 576 13 17
Genomic Location (Zv9):
Chromosome Zv9_NA436 (position 15627)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150177.1 15627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAACTCTTGAATGTCTACTGTGTGCTGCAGTTCTTTGATGGTCTTGTT[G/A]TGAGTAATCTCCATTGTGATTACTTTTTTTCTGAAAAAATTCACTGCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link