ENSDARG00000087509

Ensembl ID:
ENSDARG00000087509

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36106 Nonsense Mutation detected in F1 DNA During 2017
sa28641 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129621 Nonsense 93 290 2 7
Genomic Location (Zv9):
Chromosome 16 (position 24014221)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22024959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGACACTGGGTTCTGACTGCTCTCTGAACATCATGAAAGCCTCTAAA[A/T]AAGATTATGGGCTTTACATCTGCCTACAATATCTCTATGGACATCTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129621 Nonsense 160 290 3 7
Genomic Location (Zv9):
Chromosome 16 (position 24013938)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22024676
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTGTATCACGGAGTCTCTTGTGATACTTTGGTTCGTATTGAAGGATA[T/A]CAGTTGATGTGGGTGAATCAGGCTGGAGGGAATCTGATGACAGACTCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link