ENSDARG00000087492

Ensembl ID:
ENSDARG00000087492
Human Orthologues:
ARAP1, ARAP2, ARAP3, GIT1, GIT2
Human Descriptions:
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 [Source:HGNC Symbol;Acc:16925]
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 [Source:HGNC Symbol;Acc:16924]
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 [Source:HGNC Symbol;Acc:24097]
G protein-coupled receptor kinase interacting ArfGAP 1 [Source:HGNC Symbol;Acc:4272]
G protein-coupled receptor kinase interacting ArfGAP 2 [Source:HGNC Symbol;Acc:4273]
Mouse Orthologues:
Arap1, Arap2, Arap3, Git1, Git2
Mouse Descriptions:
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 Gene [Source:MGI Symbol;Acc:MGI:1916960]
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 Gene [Source:MGI Symbol;Acc:MGI:2684416]
ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 Gene [Source:MGI Symbol;Acc:MGI:2147274]
G protein-coupled receptor kinase-interactor 1 Gene [Source:MGI Symbol;Acc:MGI:1927140]
G protein-coupled receptor kinase-interactor 2 Gene [Source:MGI Symbol;Acc:MGI:1347053]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7972 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130833 Nonsense 515 958 11 23
Genomic Location:
Chromosome 21 (position 42607737)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTTTACCGTAAAGCTCACCCTCTCGCCGCCAGCCAGAAACTGCTGGAC[C/T]AGGTGAGGATGTCTGCTGGTTGAACGAATTGGAATTAATTATATCTRAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pk0a3zkl