ccr6a

Ensembl ID:
ENSDARG00000087474
ZFIN ID:
ZDB-GENE-040625-126
Description:
chemokine receptor 6a [Source:RefSeq peptide;Acc:NP_001093461]
Human Orthologue:
CCR6
Human Description:
chemokine (C-C motif) receptor 6 [Source:HGNC Symbol;Acc:1607]
Mouse Orthologue:
Ccr6
Mouse Description:
chemokine (C-C motif) receptor 6 Gene [Source:MGI Symbol;Acc:MGI:1333797]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37065 Nonsense Mutation detected in F1 DNA During 2016
sa13724 Nonsense Available for shipment Available now
sa37066 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122256 Nonsense 28 375 2 2
Genomic Location (Zv9):
Chromosome 20 (position 30639381)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30710594
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGTGATTATTATGAAGGAGCTGTGGAGCCGTGTTCTGTGGAGAGCAGG[C/T]AGAAGCTTGAGAACTTCCTCCGCTTGTTTATTCATCCAATCATTTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13724
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122256 Nonsense 70 375 2 2
Genomic Location (Zv9):
Chromosome 20 (position 30639509)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30710722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTAACGTACGCCCTCTACAAGCGAACCAAGTCCATGACTGACGTGTA[T/A]CTGCTGAATGTGGCCATCGCTGACATCCTGTTTGTGGTGGCTCTGCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122256 Nonsense 284 375 2 2
Genomic Location (Zv9):
Chromosome 20 (position 30640149)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30711362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCATATGCCTTATAACCTTGTGCTGTTGTACCATACCATCAATTTATTT[G/T]AACAGCAGGAATGCAGCCATGAGGAGGCCGTCGCGTTGACCATGACCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link