ccr6a

Ensembl ID:
ENSDARG00000087474
ZFIN ID:
ZDB-GENE-040625-126
Description:
chemokine receptor 6a [Source:RefSeq peptide;Acc:NP_001093461]
Human Orthologue:
CCR6
Human Description:
chemokine (C-C motif) receptor 6 [Source:HGNC Symbol;Acc:1607]
Mouse Orthologue:
Ccr6
Mouse Description:
chemokine (C-C motif) receptor 6 Gene [Source:MGI Symbol;Acc:MGI:1333797]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13724 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13724
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122256 Nonsense 70 375 2 2
Genomic Location:
Chromosome 20 (position 30639509)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTAACGTACGCCCTCTACAAGCGAACCAAGTCCATGACTGACGTGTA[T/A]CTGCTGAATGTGGCCATCGCTGACATCCTGTTTGTGGTGGCTCTGCCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yssa14p8