PELI3

Ensembl ID:
ENSDARG00000087452
Description:
pellino homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:30010]
Human Orthologue:
PELI3
Human Description:
pellino homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:30010]
Mouse Orthologue:
Peli3
Mouse Description:
pellino 3 Gene [Source:MGI Symbol;Acc:MGI:1924963]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16556 Nonsense Available for shipment Available now
sa30885 Nonsense Mutation detected in F1 DNA During 2017
sa40857 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16556
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127428 Nonsense 181 477 4 6
Genomic Location (Zv9):
Chromosome 7 (position 19412112)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17884971
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGGAGAAGGAGGACAGTCGGCCCAGAGCACCATCTCCCGCTATGCCTG[T/A]CGTATCATGTGTGAGCGCAGCGCCCCRTACACAGCRCGAATATATGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127428 Nonsense 309 477 6 6
ENSDART00000127428 Nonsense 309 477 6 6
Genomic Location (Zv9):
Chromosome 7 (position 19397915)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17870774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGCTTTGGCGGACTCCTAGCGGTCTTCGCCACACCCCGACTCTTAAA[C/T]AGCTGGAGTCTCTTCGCCAGGAGTTAAACGCTGCCCGTCCCCAGTGCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40857
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127428 Nonsense 309 477 6 6
ENSDART00000127428 Nonsense 309 477 6 6
Genomic Location (Zv9):
Chromosome 7 (position 19397915)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 17870774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGCTTTGGCGGACTCCTAGCGGTCTTCGCCACACCCCGACTCTTAAA[C/T]AGCTGGAGTCTCTTCGCCAGGAGTTAAACGCTGCCCGTCCCCAGTGCCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link