MCC

Ensembl ID:
ENSDARG00000087450
Description:
mutated in colorectal cancers [Source:HGNC Symbol;Acc:6935]
Human Orthologue:
MCC
Human Description:
mutated in colorectal cancers [Source:HGNC Symbol;Acc:6935]
Mouse Orthologue:
Mcc
Mouse Description:
mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5275 Splice Site, Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa5275
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128214 Splice Site, Nonsense 397 770 10 19
Genomic Location:
Chromosome 5 (position 595667)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTGTGTGAGTGTGTGTGTGTGTGTGTATGTATATATAGTTAAAGAGT[C/T]AAGTTAAAGAGAAATATGTGAGAAACAATGTGATGAAGATGTTCATGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ol0vtkp9