LOC570404

Ensembl ID:
ENSDARG00000087439
Human Orthologue:
ZNF628
Human Description:
zinc finger protein 628 [Source:HGNC Symbol;Acc:28054]
Mouse Orthologue:
Zfp628
Mouse Description:
zinc finger protein 628 Gene [Source:MGI Symbol;Acc:MGI:2665174]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22773 Nonsense Mutation detected in F1 DNA During 2014
sa15489 Essential Splice Site Available for shipment Available now
sa16179 Nonsense Available for shipment Available now
sa22774 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22773
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123076 Nonsense 528 1425 4 6
Genomic Location:
Chromosome 16 (position 14376305)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGGCCCATCCTCGCACTCCATCCGATTCGCGTACTCAGTTCAACTGCT[C/A]GGCATGTGACCGATCCTTCCCTCTGCTCTCCTCTCTGCTTAACCACCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15489
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123076 Essential Splice Site 627 1425 4 6
Genomic Location:
Chromosome 16 (position 14376603)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGGCAGCAGGAGAGGTGGAGGTAGCAAGACATCTGCCGCAAATAACGG[T/A]AARAGAGCTGTAGYGGATATTNAATCACTTAATTGGTTWACTTTCAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16179
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123076 Nonsense 993 1425 6 6
Genomic Location:
Chromosome 16 (position 14378408)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAYTCAAATCCAGCCATTTCAACCAGTCCAGACACAGCAGAGRTTTATTT[T/A]GACCAATAATAATGCTCCACTCATTACTCCCCAGCCTCAAAACACATCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123076 Nonsense 1210 1425 6 6
Genomic Location:
Chromosome 16 (position 14379060)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGAGGAGAGAAGTCATATGTCCTACGGTTTCAGACAGAGGGTGAATG[T/A]GAGGGAGAAGCAGGTAAAGATAAGACTGGAATGGTCTCTCTTAACTTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zjoq9ts9