ENSDARG00000087426

Ensembl ID:
ENSDARG00000087426
Human Orthologues:
AC106886.1, C20orf27
Human Descriptions:
chromosome 20 open reading frame 27 [Source:HGNC Symbol;Acc:15873]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A6NC64]
Mouse Orthologue:
1700037H04Rik
Mouse Description:
RIKEN cDNA 1700037H04 gene Gene [Source:MGI Symbol;Acc:MGI:1914576]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39671 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39672 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39671
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129819 Essential Splice Site 6 166 1 5
Genomic Location (Zv9):
Chromosome 1 (position 45540784)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44384003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCCCTGGATTTCCCTGGCCTTATGTCGACATGGCAACAGGAAGGAAAA[G/A]TCAGTGTGTTTTCTGTTCATAATGTGTGAATATATCAGTACATGCACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129819 Nonsense 60 166 3 5
Genomic Location (Zv9):
Chromosome 1 (position 45543166)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44386385
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGACTGCTGCATTCTCTGTTTAGGCCGGATTTTTAAGGAGTCATCAC[A/T]AATATGAAATCGTCTTCTCTTTGCCGCAAGTCCCAACGTTGGGCAAAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link