LOC792560

Ensembl ID:
ENSDARG00000087417
Human Orthologue:
ZDHHC5
Human Description:
zinc finger, DHHC-type containing 5 [Source:HGNC Symbol;Acc:18472]
Mouse Orthologue:
Zdhhc5
Mouse Description:
zinc finger, DHHC domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1923573]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35763 Nonsense Mutation detected in F1 DNA During 2016
sa4577 Nonsense Mutation detected in F1 DNA During 2016
sa15335 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35763
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128508 Nonsense 288 658 7 11
Genomic Location:
Chromosome 14 (position 51275632)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTGTTCAGGTCCAGCCACCATTTCTGCGACCGCCTTTATCTGAAGCT[C/T]AACTAGCAGCTAAAGTCCTGGATAACGGCATCCAGCAGGTATTAACACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4577
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128508 Nonsense 417 658 10 11
Genomic Location:
Chromosome 14 (position 51281285)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCAGCCGAGGGGCCGCGGGGTGCCGTGGGGGAGCGGAGGGGGGTAGAT[C/A]AGGCTCGGGGGGGCTGGGCGGGGCCTCTGCGTTTGGTGGGCGGTCTTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128508 Nonsense 650 658 11 11
Genomic Location:
Chromosome 14 (position 51288085)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACCCACTCACACAAACCCGCCAGAGGGGTGAAGAAAGTGAGCGGTGTC[G/T]GAGGAACCACCTATGAGATTTCAGTATGAACGGTTATTGARTCTCCGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link