LOC792560

Ensembl ID:
ENSDARG00000087417
Human Orthologue:
ZDHHC5
Human Description:
zinc finger, DHHC-type containing 5 [Source:HGNC Symbol;Acc:18472]
Mouse Orthologue:
Zdhhc5
Mouse Description:
zinc finger, DHHC domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1923573]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35763 Nonsense Mutation detected in F1 DNA During 2016
sa15335 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35763
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128508 Nonsense 288 658 7 11
Genomic Location (Zv9):
Chromosome 14 (position 51275632)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 50028348
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTGTTCAGGTCCAGCCACCATTTCTGCGACCGCCTTTATCTGAAGCT[C/T]AACTAGCAGCTAAAGTCCTGGATAACGGCATCCAGCAGGTATTAACACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128508 Nonsense 650 658 11 11
Genomic Location (Zv9):
Chromosome 14 (position 51288085)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 50040801
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACCCACTCACACAAACCCGCCAGAGGGGTGAAGAAAGTGAGCGGTGTC[G/T]GAGGAACCACCTATGAGATTTCAGTATGAACGGTTATTGARTCTCCGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link