ENSDARG00000087380

Ensembl ID:
ENSDARG00000087380

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20304 Nonsense Available for shipment Available now
sa31404 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20304
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124719 Nonsense 598 896 2 6
Genomic Location (Zv9):
Chromosome 4 (position 37070201)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 61547919
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTCCTCTACACAGGCTACATGGCTGTAAACTCACTGTTCAGTGTTGT[G/T]AGAGTTTGTCTTCAGTTCTACAATCCTCAAACTGCGTCTTGAGAGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31404
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124719 Essential Splice Site 717 896 4 6
Genomic Location (Zv9):
Chromosome 4 (position 37125970)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 61603688
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTTGGATCATGGAGGAGACACAAGGATTACTGCAGGACTGCACAAAT[G/A]TACGACTACACGCACACACACACACACACACATACACACTCTTTCACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link