DNAH5

Ensembl ID:
ENSDARG00000087373
Description:
dynein, axonemal, heavy chain 5 [Source:HGNC Symbol;Acc:2950]
Human Orthologue:
DNAH5
Human Description:
dynein, axonemal, heavy chain 5 [Source:HGNC Symbol;Acc:2950]
Mouse Orthologue:
Dnahc5
Mouse Description:
dynein, axonemal, heavy chain 5 Gene [Source:MGI Symbol;Acc:MGI:107718]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17217 Nonsense Available for shipment Available now
sa16138 Nonsense Available for shipment Available now
sa22759 Nonsense Available for shipment Available now
sa12420 Nonsense Available for shipment Available now
sa36046 Nonsense Mutation detected in F1 DNA During 2017
sa39082 Nonsense Mutation detected in F1 DNA During 2017
sa11127 Nonsense Available for shipment Available now
sa12187 Essential Splice Site Available for shipment Available now
sa17649 Splice Site, Nonsense Available for shipment Available now
sa11262 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17217
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123150 Nonsense 151 1974 3 32
Genomic Location (Zv9):
Chromosome 16 (position 10484460)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9267546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCYAACTTCCACWACATTTTTAACCTGCGTGACCTCTCCCGCATCTGG[C/T]AGGGAATGCTTGGTGTGACTGCAGAGGTCATCAGTACACCTCAAGTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16138
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123150 Nonsense 203 1974 4 32
Genomic Location (Zv9):
Chromosome 16 (position 10486561)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9269647
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGGACGTGGCCTGGTTTGACAGCACACTTGCCAAGCTRGTGGAAGAA[C/T]AGCTTGGGGAAGAAGAACGAGAGGTTGTGGATCTCGGGGTRGATTCTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22759
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123150 Nonsense 347 1974 7 32
Genomic Location (Zv9):
Chromosome 16 (position 10494052)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9277138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGTAGTTCCTACAACACCGCTAACCTGATGGAGGACCTGAAGGGCT[T/A]GTACAGGACTGCCGGACAACAGGGCAAAGGCATTAGCTTTATTTTCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12420
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123150 Nonsense 800 1974 14 32
Genomic Location (Zv9):
Chromosome 16 (position 10526028)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9307737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACAGGCTGACCATAGCTAATKTGGACCTCCAGAAAGCCCAGGCAGAAT[T/A]GGATGCGAAACAAGCAGAGCTGGATGTGGTTCAAGMAGAGTATGAGAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123150 Nonsense 804 1974 14 32
Genomic Location (Zv9):
Chromosome 16 (position 10526039)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9307748
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATAGCTAATTTGGACCTCCAGAAAGCCCAGGCAGAATTGGATGCGAAA[C/T]AAGCAGAGCTGGATGTGGTTCAAGCAGAGTATGAGAAGGCAATGATAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123150 Nonsense 1025 1974 17 32
Genomic Location (Zv9):
Chromosome 16 (position 10538971)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9320680
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTTGGACAATGTCTTGGAGAAGAACTTCATCAAGACTGGCTTCACTTA[T/G]AAGGTATTGTTATAAAGAGCAATAAGCAAAAGAGGTCTGACATCACTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11127
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123150 Nonsense 1386 1974 24 32
Genomic Location (Zv9):
Chromosome 16 (position 10567535)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9349244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGGAGAAAGATATGCTGAGGGAGTTATTCTTGACYTGGAGAAGACCTG[G/A]GAAGAGTCTGAGCCTCGCACACCTCTCATCTGCTTCCTGTCTATGGGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12187
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123150 Essential Splice Site 1516 1974 25 32
Genomic Location (Zv9):
Chromosome 16 (position 10570870)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9352579
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACGAGCCTCCACAGGGACTGAAAGCYGGACTTAAGAGRACTTATGGAG[G/A]TGAGCYTGGTCTTTGGATATTTAGTTCTTGYYTGACTGACAGTTTNNCCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17649
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123150 Splice Site, Nonsense 1847 1974 30 32
Genomic Location (Zv9):
Chromosome 16 (position 10584733)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9366442
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGATGACAGGCKTCTTCRACYCACAGGGCTTTCTGACAGCTATGAGA[C/T]AGGTGAGTAACTATCACACAARCGCTTCTACTAAACTTACATTTGTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11262
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123150 Nonsense 1891 1974 31 32
Genomic Location (Zv9):
Chromosome 16 (position 10593358)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 9375067
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCACGCAGCCTCCTGCAGAAGGGGTRTAYGTCTATGGCCTMTACCTT[G/T]AAGGGGCTGGCTGGGACCGCAGGAACTGCAAACTYATTGATTCCAAACCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link