si:ch211-198c19.2

Ensembl ID:
ENSDARG00000087369
ZFIN ID:
ZDB-GENE-100922-266
Human Orthologue:
KIAA1009
Human Description:
KIAA1009 [Source:HGNC Symbol;Acc:21107]
Mouse Orthologue:
4922501C03Rik
Mouse Description:
RIKEN cDNA 4922501C03 gene Gene [Source:MGI Symbol;Acc:MGI:1925343]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22910 Nonsense Available for shipment Available now
sa22911 Essential Splice Site Available for shipment Available now
sa42783 Nonsense Mutation detected in F1 DNA During 2017
sa22912 Nonsense Available for shipment Available now
sa22913 Nonsense Available for shipment Available now
sa12261 Nonsense Available for shipment Available now
sa16595 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22910
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126898 Nonsense 266 1367 8 25
ENSDART00000142104 Nonsense 266 1367 9 26
Genomic Location (Zv9):
Chromosome 16 (position 40574016)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37958816
KASP Assay ID:
2261-0098.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCAGTTCCAAGTTTGGCCGTTGCGAGAGAAAATCGTCCAGAAAGCAAA[C/T]AAACAGACATGCCAGCACTGGAACCCGCAGGTATGGCAAGCAGTTGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22911
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126898 Essential Splice Site 665 1367 15 25
ENSDART00000142104 Essential Splice Site 665 1367 16 26
Genomic Location (Zv9):
Chromosome 16 (position 40588410)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37973210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAAAGAGATGAAAGAACAAGAGACTCTGATTCAGGGTTACCATCAGG[T/C]AAGTCTTTCTCAAGGATAAAAATGGAGAGGAAAAAATGACCATTTCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42783
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126898 Nonsense 788 1367 19 25
ENSDART00000142104 Nonsense 788 1367 20 26
Genomic Location (Zv9):
Chromosome 16 (position 40599013)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37983813
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCAATAACCATTTTGCTTTTTCTGTCAGGCGATAAAGGTTTCGAATTG[A/T]AACTGCTCCATGACAAACATCGAGAGGAGGTCACAGAGCTGAAGAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126898 Nonsense 869 1367 19 25
ENSDART00000142104 Nonsense 869 1367 20 26
Genomic Location (Zv9):
Chromosome 16 (position 40599256)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37984056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGGCAAAAGAAAAAGCAGGTGAAGCAAAAAGAATCCAAGACCTAGAG[C/T]GACAGGTCAGTCACTATGACATGCTCTCTCTCTCTTTCTCTCTCTCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126898 Nonsense 946 1367 20 25
ENSDART00000142104 Nonsense 946 1367 21 26
Genomic Location (Zv9):
Chromosome 16 (position 40600979)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37985779
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGGGCCGAGATGAAGCAGCCAAACGCAGCCTCCGAGCAATGGAACAA[C/T]AGTATCACAGAATCAAAGTACTCTTTTCATATACAGATTACGTGTTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126898 Nonsense 1288 1367 24 25
ENSDART00000142104 Nonsense 1288 1367 25 26
Genomic Location (Zv9):
Chromosome 16 (position 40607517)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37992317
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACTAGCCTAGAGCAAAAAATTCAGWCCATGGARTTCAGATACAGTCAA[C/T]GAGAGAAACAACTTCAGCAGGTAAAACACCCACACATTCTTCTATATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16595
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126898 Nonsense 1291 1367 24 25
ENSDART00000142104 Nonsense 1291 1367 25 26
Genomic Location (Zv9):
Chromosome 16 (position 40607526)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37992326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAGCAAAAAATTCAGWCCATGGARTTCAGATACAGTCAAYGAGAGAAA[C/T]AACTTCAGCAGGTAAAACACCCACACATTCTTCTATATGTGCTATACTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link