LOC100334753

Ensembl ID:
ENSDARG00000087365

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9736 Nonsense Available for shipment Available now
sa10775 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9736
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126182 Nonsense 316 1007 1 8
Genomic Location:
Chromosome 3 (position 2153743)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATGAACATGAAGAGCCAGAAGTATGMTGACCAAGAAGAAAGAGATTA[T/A]ACGAAGCTCTTAGATTCAAACAAAGAGATGATCCTGAAATTAGCCAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10775
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126182 Essential Splice Site 758 1007 4 8
Genomic Location:
Chromosome 3 (position 2155368)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTCTGATGGACTGAAGAGTCCAAACTGTACACTGGAGACACTGAGGT[T/A]TGACATTCACACACACACTCRTACACTAYGGMYAGTKTAGTTGATCAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v7eg7r14