c3b

Ensembl ID:
ENSDARG00000087359
ZFIN ID:
ZDB-GENE-990415-36
Description:
complement component c3b [Source:RefSeq peptide;Acc:NP_571318]
Human Orthologue:
C3
Human Description:
complement component 3 [Source:HGNC Symbol;Acc:1318]
Mouse Orthologue:
C3
Mouse Description:
complement component 3 Gene [Source:MGI Symbol;Acc:MGI:88227]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32792 Nonsense Mutation detected in F1 DNA During 2016
sa16773 Nonsense Available for shipment Available now
sa12266 Essential Splice Site Available for shipment Available now
sa25701 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15993 Nonsense Available for shipment Available now
sa18244 Essential Splice Site Available for shipment Available now
sa13120 Nonsense Available for shipment Available now
sa39716 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32792
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019644 Nonsense 191 1654 5 41
ENSDART00000127714 Nonsense 168 1628 4 40
Genomic Location:
Chromosome 1 (position 56782599)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAGCATCAGATGCAATAAAGGCAGAGAAAGGTGTGAAGTCTTCAATCTA[C/A]AACATCCCTGATGTTACTAGGTGTGTACAGTAAATCACTGTTGAGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16773
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019644 Nonsense 787 1654 19 41
ENSDART00000127714 Nonsense 764 1628 18 40
Genomic Location:
Chromosome 1 (position 56794186)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAACATTTTGTATCTTTCTCATAACCCAGTTCAAAACCAAGCAAGGAC[A/T]AAGTGATTTACCTARAAGACTCTATTACTACYTGGCAGATCTTGGCTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12266
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019644 Essential Splice Site 857 1654 20 41
ENSDART00000127714 Essential Splice Site 834 1628 19 40
Genomic Location:
Chromosome 1 (position 56794487)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAATCAAGGCCATTATTCACAACTACACCCCCAAACACCTGAAGAAG[G/A]TAGRTTTGRCATTCAGAATTTATTAATAAATACCACASGCATCGTAGTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019644 Essential Splice Site 947 1654 23 41
ENSDART00000127714   None 1628 None 40
Genomic Location:
Chromosome 1 (position 56796047)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTACAAAATCTGTTCATGCCTCTTCTTTTACATTCTCTGTTTTTATGTC[A/T]AATGGAACAGGGGAAAAACCCTTAGTTCTTCGATCTGGTATACCAGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15993
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019644 Nonsense 1100 1654 26 41
ENSDART00000127714 Nonsense 1074 1628 25 40
Genomic Location:
Chromosome 1 (position 56797318)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTAAGCTTATTGCTATAGAGGAAAMTGTGATCTGCAGCGCCCTCAAGTG[G/A]CTAGTTATGCACAAACAACTACCWGATGGCTCTTTTAAAGAGGATAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18244
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019644 Essential Splice Site 1125 1654 27 41
ENSDART00000127714 Essential Splice Site 1099 1628 26 40
Genomic Location:
Chromosome 1 (position 56797484)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATATATTTTATAAATTTGTACTATTCTGTTCACNYTTTGCTTTATWCCA[G/A]GGTGGCATAGAAGGCCAAAACACTGATGTCTCTCTGACAGCCTTTGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13120
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019644 Nonsense 1446 1654 36 41
ENSDART00000127714 Nonsense 1420 1628 35 40
Genomic Location:
Chromosome 1 (position 56807782)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AWTGTATAAAGAATCATCTGCTTTGATTNNTGTCTCATTAGGTTTCTCAT[A/T]AGGAATCAGAAACDCTTGTCTTCAGAATGCACAAGACTTTTAACGTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019644 Essential Splice Site 1608 1654 41 41
ENSDART00000127714 Essential Splice Site 1582 1628 40 40
Genomic Location:
Chromosome 1 (position 56813163)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCCCTAAGTCAGCCACTCATTAATGTATGGTCTTTACTTTTGTGTCTA[G/A]TCTGCAGTACATCATAGGAGAGCAGACCTGGATTGAATACTGGCCTACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link