ENSDARG00000087314

Ensembl ID:
ENSDARG00000087314

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44380 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa30358 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44380
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110893 Splice Site, Nonsense 433 607 12 12
Genomic Location (Zv9):
Chromosome Zv9_scaffold3514 (position 86633)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 60230620
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACACACACACAGCTGTGGTTATAAATGTGTGTGTTCTTGTGTTCAGA[T/A]GTCTGTTTCCTCACTCTGGATCCAAATACAGCACATACTCAACTTATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30358
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110893 Nonsense 480 607 12 12
Genomic Location (Zv9):
Chromosome Zv9_scaffold3514 (position 86773)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 60230760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCCATATCCTGATCATCCAGACAGATTTGATGATCATCATCAGGTGT[T/A]GTGCAGAGAGAGTGTGTGTGGACGCTGTTATTGGGGGATTGACTGGAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link