ctsa

Ensembl ID:
ENSDARG00000087307
ZFIN ID:
ZDB-GENE-030131-537
Description:
lysosomal protective protein [Source:RefSeq peptide;Acc:NP_956844]
Human Orthologue:
CTSA
Human Description:
cathepsin A [Source:HGNC Symbol;Acc:9251]
Mouse Orthologue:
Ctsa
Mouse Description:
cathepsin A Gene [Source:MGI Symbol;Acc:MGI:97748]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14856 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14856
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123867 Nonsense 356 379 10 10
Genomic Location:
Chromosome 6 (position 55292226)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCGCTTCACATCTCTCCTAATGCTCTGGACTGGGTCATCTGCAGGTA[C/A]ACCGACTGCACTTTAGTTGCCAGGAGGTTGTTATCACARAATAAAACCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xeej5523